serpinb1l2

Ensembl ID:
ENSDARG00000070396
ZFIN ID:
ZDB-GENE-041001-117
Description:
serpin peptidase inhibitor, clade B, member 1, like 2 [Source:RefSeq peptide;Acc:NP_001038636]
Human Orthologue:
SERPINB1
Human Description:
serpin peptidase inhibitor, clade B (ovalbumin), member 1 [Source:HGNC Symbol;Acc:3311]
Mouse Orthologues:
Serpinb1a, Serpinb1b, Serpinb1c
Mouse Descriptions:
serine (or cysteine) peptidase inhibitor, clade B, member 1a Gene [Source:MGI Symbol;Acc:MGI:1913472
serine (or cysteine) peptidase inhibitor, clade B, member 1b Gene [Source:MGI Symbol;Acc:MGI:2445361
serine (or cysteine) peptidase inhibitor, clade B, member 1c Gene [Source:MGI Symbol;Acc:MGI:2445363

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16540 Splice Site, Nonsense Available for shipment Available now
sa43453 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077787 Splice Site, Nonsense 189 382 4 6
Genomic Location (Zv9):
Chromosome 20 (position 26948007)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27019310
KASP Assay ID:
2261-4398.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACACATTTKATRCACATGCGACTAAAGAAATGCCATTTAAAATAAAC[C/T]AGGTGTGACCCACANTTTTTTTTATTAGTGTGTTGAATTATTTWAWACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077787 Nonsense 377 382 6 6
Genomic Location (Zv9):
Chromosome 20 (position 26948745)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27020048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGTTCTTCATCAGACACAACCCCACTAACAGCATCCTTTTTCTGGGC[A/T]GATTCAGAGCCCCATCCTAGCTATGTAGTTCTTTTTCTTTGTTATATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link