tlr19

Ensembl ID:
ENSDARG00000070392
ZFIN ID:
ZDB-GENE-040220-3
Description:
Toll-like receptor 19 [Source:UniProtKB/TrEMBL;Acc:Q6TQH1]
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103242 Nonsense 906 912 6 6
ENSDART00000139243 Nonsense 173 177 3 3
Genomic Location:
Chromosome 16 (position 24919615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATCTGGACTGGCCAGAGGATGAAGGARACCGAGAGCACTTCTGGGAT[C/T]GRCTAAGGAGGAACATTRCAGAAGATTCTGTAAGTACAAAAACATCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zlqyykm0