flad1

Ensembl ID:
ENSDARG00000070390
ZFIN ID:
ZDB-GENE-040822-44
Description:
FAD synthaseMolybdenum cofactor biosynthesis protein-like regionFAD synthase region [Source:UniProtK
Human Orthologue:
FLAD1
Human Description:
FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24671]
Mouse Orthologue:
Flad1
Mouse Description:
RFad1, flavin adenine dinucleotide synthetase, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:24430

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103235 Nonsense 66 497 3 8
ENSDART00000137783 Nonsense 183 338 3 3
ENSDART00000143957 Nonsense 66 106 3 3

The following transcripts of ENSDARG00000070390 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 25052351)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACRGTGGAGCGCATCACTGTGGTACCGGACGTCCAGGAAGTCATCGCT[A/T]AAGAAGTWTCTCAGCTTTCCTCCACCGTTACTCACCTCATCACATCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6beswr7s