foxf2

Ensembl ID:
ENSDARG00000070389
ZFIN ID:
ZDB-GENE-041001-130
Human Orthologue:
FOXF2
Human Description:
forkhead box F2 [Source:HGNC Symbol;Acc:3810]
Mouse Orthologue:
Foxf2
Mouse Description:
forkhead box F2 Gene [Source:MGI Symbol;Acc:MGI:1347479]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103232 Nonsense 152 429 1 2
ENSDART00000138068 Nonsense 50 309 1 2
Genomic Location (Zv9):
Chromosome 20 (position 26720323)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26791626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTTACCAGTTTTTACAAACACGCTTCCCGTTTTTCCGAGGCTCTTA[T/A]CAGGGCTGGAAGAACTCTGTTCGGCACAACTTGTCTCTGAACGAGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link