casp6l2

Ensembl ID:
ENSDARG00000070368
ZFIN ID:
ZDB-GENE-060312-12
Description:
caspase 6, apoptosis-related cysteine peptidase, like 2 [Source:RefSeq peptide;Acc:NP_001035069]
Human Orthologue:
CASP6
Human Description:
caspase 6, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1507]
Mouse Orthologue:
Casp6
Mouse Description:
caspase 6 Gene [Source:MGI Symbol;Acc:MGI:1312921]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20056 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103182 Essential Splice Site None 245 1 6
ENSDART00000131808 Essential Splice Site 18 254 1 7

The following transcripts of ENSDARG00000070368 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 33110424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAACAAATCAATAATGATGGCAACTGAAACCACGAGCAATGAATCAG[G/A]TAAGGGCTTCATCTGGTTGAATAAAATAATTGTGTAAAATGTTACTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4z8gwtwk