ENSDARG00000070366

Ensembl ID:
ENSDARG00000070366

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21947 Nonsense Mutation detected in F1 DNA During 2014
sa21948 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077970 Nonsense 123 1374 3 24
Genomic Location:
Chromosome 11 (position 35956776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGGAGTTTGACTGCCGTACTCCAGAGGAATGGCTGGCTTTAGGTTA[T/A]GAGCCAGGCTCCATGAATCGCAAACCCATTCCAGCCAAAGCCCTGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077970 Essential Splice Site 148 1374 3 24
Genomic Location:
Chromosome 11 (position 35956851)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATTCCAGCCAAAGCCCTGTTGCCGACAAAAAACAGCATCCCACCTGG[T/C]ACGATACTGTCGAAACCCTCTGCAAATACCTGACTTATTGTAGTCGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixa7wr02