ENSDARG00000070366

Ensembl ID:
ENSDARG00000070366

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21947 Nonsense Available for shipment Available now
sa21948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077970 Nonsense 123 1374 3 24
Genomic Location (Zv9):
Chromosome 11 (position 35956776)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34454636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGGAGTTTGACTGCCGTACTCCAGAGGAATGGCTGGCTTTAGGTTA[T/A]GAGCCAGGCTCCATGAATCGCAAACCCATTCCAGCCAAAGCCCTGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077970 Essential Splice Site 148 1374 3 24
Genomic Location (Zv9):
Chromosome 11 (position 35956851)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34454561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATTCCAGCCAAAGCCCTGTTGCCGACAAAAAACAGCATCCCACCTGG[T/C]ACGATACTGTCGAAACCCTCTGCAAATACCTGACTTATTGTAGTCGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link