cx30.9

Ensembl ID:
ENSDARG00000070362
ZFIN ID:
ZDB-GENE-050616-2
Description:
connexin 30.9 [Source:RefSeq peptide;Acc:NP_001007289]
Human Orthologues:
GJB4, GJB5
Human Descriptions:
gap junction protein, beta 4, 30.3kDa [Source:HGNC Symbol;Acc:4286]
gap junction protein, beta 5, 31.1kDa [Source:HGNC Symbol;Acc:4287]
Mouse Orthologues:
Gjb4, Gjb5
Mouse Descriptions:
gap junction protein, beta 4 Gene [Source:MGI Symbol;Acc:MGI:95722]
gap junction protein, beta 5 Gene [Source:MGI Symbol;Acc:MGI:95723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7886 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103163 Nonsense 99 267 1 1
Genomic Location:
Chromosome 19 (position 38667786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCGTCACTTGTCCATCTCTYATGGTGGTCGCTCACGTCAAATATCGA[C/T]AAATGAAGAATGTGAAGTACAACACTGCCCGCAATGGTGAAAACATGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ksume6s6