hoxc13a

Ensembl ID:
ENSDARG00000070353
ZFIN ID:
ZDB-GENE-000822-4
Description:
Homeobox protein Hox-C13a [Source:UniProtKB/Swiss-Prot;Acc:Q6JIY5]
Human Orthologue:
HOXC13
Human Description:
homeobox C13 [Source:HGNC Symbol;Acc:5125]
Mouse Orthologue:
Hoxc13
Mouse Description:
homeobox C13 Gene [Source:MGI Symbol;Acc:MGI:99560]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37764 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103149 Nonsense 164 306 1 2
Genomic Location (Zv9):
Chromosome 23 (position 36105013)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35954666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTTTCTATCCGAGTTTTGCCAGCTCTTACCAGGCTGTTCCAGGATA[T/G]CTAGATATGTCGGTGGTTCCGAGTATTAGCGCTCATCCCGAGCCACGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biliary atresia: Genome-wide association study identifies a susceptibility locus for biliary atresia on 10q24.2. (View Study)
  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link