hoxc12a

Ensembl ID:
ENSDARG00000070352
ZFIN ID:
ZDB-GENE-000822-6
Description:
homeo box C12a [Source:RefSeq peptide;Acc:NP_001104229]
Human Orthologue:
HOXC12
Human Description:
homeobox C12 [Source:HGNC Symbol;Acc:5124]
Mouse Orthologue:
Hoxc12
Mouse Description:
homeobox C12 Gene [Source:MGI Symbol;Acc:MGI:96194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4232 Nonsense Mutation detected in F1 DNA During 2014
sa16985 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103147 Nonsense 200 274 2 2
Genomic Location:
Chromosome 23 (position 36116501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGGACTCTCATGAACCCGTGCTATGCCCTCTCCAGGTGCCCCGTGGTA[C/A]CMGATGCACACCCGGACCCGCAAGAAACGAAAACCCTATTCCAAACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103147 Nonsense 255 274 2 2
Genomic Location:
Chromosome 23 (position 36116664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGTCTGACAGGCTCARTCTCAGCGACCAACAGGTTAAAATTTGGTTC[C/T]AAAATCGGCGGATGAAGAAAAAGAGACTGTTGCTGAGGGARCAGGCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w2qbuklm