hoxc11a

Ensembl ID:
ENSDARG00000070351
ZFIN ID:
ZDB-GENE-990415-111
Description:
Homeobox protein Hox-C11a [Source:UniProtKB/Swiss-Prot;Acc:Q58EL0]
Human Orthologue:
HOXC11
Human Description:
homeobox C11 [Source:HGNC Symbol;Acc:5123]
Mouse Orthologue:
Hoxc11
Mouse Description:
homeobox C11 Gene [Source:MGI Symbol;Acc:MGI:96193]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17170 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103146 Nonsense 239 306 2 2
ENSDART00000133760 Nonsense 235 302 2 2
Genomic Location:
Chromosome 23 (position 36128537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTATANTTTTTATCCTAAGGTACCCCGCGCACAAGAAAGAAGAGATG[T/A]CCATACTCCAAATTTCAGATTCGTGAACTGGAGCGAGAATTTTTCTTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dnc87jdm