hoxc10a

Ensembl ID:
ENSDARG00000070348
ZFIN ID:
ZDB-GENE-990415-110
Description:
Homeo box C10a [Source:UniProtKB/TrEMBL;Acc:A2BE66]
Human Orthologues:
HOXC10, HOXD10
Human Descriptions:
homeobox C10 [Source:HGNC Symbol;Acc:5122]
homeobox D10 [Source:HGNC Symbol;Acc:5133]
Mouse Orthologues:
Hoxc10, Hoxd10
Mouse Descriptions:
homeobox C10 Gene [Source:MGI Symbol;Acc:MGI:96192]
homeobox D10 Gene [Source:MGI Symbol;Acc:MGI:96202]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44032 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053295 Nonsense 307 337 2 3
ENSDART00000130260 Nonsense 307 337 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36137815)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35987468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGAGAGCGCCGTCTGGAGATCAGCAAGAGTATCAACCTCACAGACAGA[C/T]AGGTCAAGATCTGGTTCCAAAACAGACGGATGAAGCTAAAGAAGCTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link