or137-9

Ensembl ID:
ENSDARG00000070347
ZFIN ID:
ZDB-GENE-070806-29
Description:
odorant receptor, family H, subfamily 137, member 5 [Source:RefSeq peptide;Acc:NP_001124276]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40797 Nonsense Mutation detected in F1 DNA During 2017
sa40798 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065700 Nonsense 264 310 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52842940)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52891945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGTATGCTCAACTGTTACCAGCCGATCGGTCAATATTGCTCTTCTG[T/A]AATTACCTTCTGACAAATTTACTACCGCGACTGCTCACCCCACTGATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065700 Nonsense 310 310 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52843076)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52892081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCATTGTTGCATGTAAATTAGTTATTGTAAAGGTTGAATCAACCAAA[C/T]AATAATTAAGAGAAGCCTCCTAATCTAGCTGTTTGTCATTTAATTTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link