hoxc8a

Ensembl ID:
ENSDARG00000070346
ZFIN ID:
ZDB-GENE-990415-114
Description:
Homeobox protein Hox-C8a [Source:UniProtKB/Swiss-Prot;Acc:Q68EH7]
Human Orthologue:
HOXC8
Human Description:
homeobox C8 [Source:HGNC Symbol;Acc:5129]
Mouse Orthologue:
Hoxc8
Mouse Description:
homeobox C8 Gene [Source:MGI Symbol;Acc:MGI:96198]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39422 Nonsense Mutation detected in F1 DNA During 2016
sa15792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103139 Nonsense 12 250 1 2
Genomic Location (Zv9):
Chromosome 23 (position 36153024)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36002677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATGCTAGATAAACATGAGCTCTTATTTTGTTAACCCTCTTTTTTCC[A/T]AGTACAAAGGCGGCGAAACATTAGAGCCAACTTACTACGACTGCAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103139 Nonsense 129 250 1 2
Genomic Location (Zv9):
Chromosome 23 (position 36153376)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36003029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGTAAATCGTCCAATAGCACTAACCCTGGAGAAGGACAAGGCCACT[T/G]AAGTCAAAACTCCTCTCCGAGCCTCATGTTCCCTTGGATGCGGCCTCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link