or137-3

Ensembl ID:
ENSDARG00000070344
ZFIN ID:
ZDB-GENE-070806-24
Description:
odorant receptor, family H, subfamily 137, member 3 [Source:RefSeq peptide;Acc:NP_001122055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33971 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103138 Nonsense 183 310 1 1
Genomic Location (Zv9):
Chromosome 6 (position 52827371)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52876376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTCTCTGTAGTACATCTAATTTGTATAGCACACCGTACCATGAAGAA[C/T]AGAGTAAAATTACACATGGGATATATACAACTGTTGTGTGGGTAATTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link