hoxc6a

Ensembl ID:
ENSDARG00000070343
ZFIN ID:
ZDB-GENE-990415-113
Description:
Homeobox protein Hox-C6a [Source:UniProtKB/Swiss-Prot;Acc:P15862]
Human Orthologue:
HOXC6
Human Description:
homeobox C6 [Source:HGNC Symbol;Acc:5128]
Mouse Orthologue:
Hoxc6
Mouse Description:
homeobox C6 Gene [Source:MGI Symbol;Acc:MGI:96197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12505 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103035 Essential Splice Site 112 222 None 3
ENSDART00000103136 Essential Splice Site 135 231 None 2
ENSDART00000130090 Essential Splice Site 112 208 None 2
Genomic Location:
Chromosome 23 (position 36167420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACATTCARATCTACCCGTGGATGCAGCGCATGAACTCGCACAGCGG[T/A]GARTTTTTACTGYGACTTAGGACATACCCTGGTGGAATTGGTCTGTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vnvpzft6