hoxc3a

Ensembl ID:
ENSDARG00000070339
ZFIN ID:
ZDB-GENE-980526-532
Description:
Homeobox protein Hox-C3a [Source:UniProtKB/Swiss-Prot;Acc:P28174]
Human Orthologues:
HOXA3, HOXB3, HOXD3
Human Descriptions:
homeobox A3 [Source:HGNC Symbol;Acc:5104]
homeobox B3 [Source:HGNC Symbol;Acc:5114]
homeobox D3 [Source:HGNC Symbol;Acc:5137]
Mouse Orthologues:
Hoxa3, Hoxb3, Hoxd3
Mouse Descriptions:
homeobox A3 Gene [Source:MGI Symbol;Acc:MGI:96175]
homeobox B3 Gene [Source:MGI Symbol;Acc:MGI:96184]
homeobox D3 Gene [Source:MGI Symbol;Acc:MGI:96207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37765 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082472 Essential Splice Site None 254 1 5
ENSDART00000082473   None 250 None 2

The following transcripts of ENSDARG00000070339 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 36174251)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36023904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGGTCTGTAGAAGTTCGACTCTCCCAAATGGATCCCAGGCGGCTGCC[G/A]TAAGTTAATAATCTTGTTTTCCTATTTTTTAATTAAATGTACTTTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082472 Nonsense 24 254 3 5
ENSDART00000082473   None 250 1 2

The following transcripts of ENSDARG00000070339 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 36196709)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36046362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGTGCGCAAGGCTATTGGAGGAGGCCACCACGTGACTACATTGTTTA[C/A]TCTTGTTGGCAAACAATTAAAGACGCGAGTAAGTGTATTTTTTGGCTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link