hoxc1a

Ensembl ID:
ENSDARG00000070337
ZFIN ID:
ZDB-GENE-000822-2
Description:
Homeobox protein Hox-C1a [Source:UniProtKB/Swiss-Prot;Acc:Q98SH9]
Human Orthologues:
HOXA1, HOXB1, HOXD1
Human Descriptions:
homeobox A1 [Source:HGNC Symbol;Acc:5099]
homeobox B1 [Source:HGNC Symbol;Acc:5111]
homeobox D1 [Source:HGNC Symbol;Acc:5132]
Mouse Orthologues:
Hoxa1, Hoxb1, Hoxd1
Mouse Descriptions:
homeobox A1 Gene [Source:MGI Symbol;Acc:MGI:96170]
homeobox B1 Gene [Source:MGI Symbol;Acc:MGI:96182]
homeobox D1 Gene [Source:MGI Symbol;Acc:MGI:96201]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37766 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24386 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103131 Essential Splice Site 189 302 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36234696)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36084349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATTATATTTATGCTTTTAATATACATTTATATTGCATTTCTTTTAC[A/C]GCTAAGATACAACTGGGAAAATGCTCGGACCGGGAGCTGAAGACGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103131 Nonsense 270 302 2 2
Genomic Location (Zv9):
Chromosome 23 (position 36234940)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 36084593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAGCGAAACACAAGTGAAGATCTGGTTTCAGAACAGACGCATGAAA[C/T]AGAAGAAAATGCTGCGGGAAGGCCTAGCTCAAGGATTAATGCTGATTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link