LOC100148804

Ensembl ID:
ENSDARG00000070331
Human Orthologues:
MUC5AC, MUC6
Human Descriptions:
mucin 5AC, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7515]
mucin 6, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7517]
Mouse Orthologues:
Muc5ac, Muc5b, Muc6
Mouse Descriptions:
mucin 5, subtype B, tracheobronchial Gene [Source:MGI Symbol;Acc:MGI:1921430]
mucin 5, subtypes A and C, tracheobronchial/gastric Gene [Source:MGI Symbol;Acc:MGI:104697]
mucin 6, gastric Gene [Source:MGI Symbol;Acc:MGI:2663233]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24613 Nonsense Available for shipment Available now
sa15547 Essential Splice Site Available for shipment Available now
sa32517 Nonsense Mutation detected in F1 DNA During 2016
sa44236 Nonsense Mutation detected in F1 DNA During 2016
sa5096 Nonsense Mutation detected in F1 DNA During 2016
sa8866 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Nonsense 284 2870 8 47
Genomic Location:
Chromosome 25 (position 8572249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTGATGGACATGAGAATATTTCAGAAAGCCTGTGTGAGCGACCTGTG[T/A]CAATGTTATGGCAACCATGACTGTCTGTGCAACACACTAACAGAGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Essential Splice Site 553 2870 14 47
Genomic Location:
Chromosome 25 (position 8575405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGTTGTACATTGTAGCCAGCACTGAAGAGAAAGGAAAAATGACTGG[T/C]GAGWYTATAAAAGYCTTTGGGAAATGTGTATAGTTTTCTGAAAATGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Nonsense 601 2870 15 47
Genomic Location:
Chromosome 25 (position 8575666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACAAAACTGTCCAGATCTTGAAATCACATTTGACAACCCATGCAGCT[T/A]GAACATGGACACAGGTGCTTATTCCATTTCCGCTCAGAACATTCATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Nonsense 1801 2870 29 47
Genomic Location:
Chromosome 25 (position 8591578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACTGCATCCACTACTTCACCAACTACTGAAACATCAACGCCTACTT[C/A]AACAGAGACACCATCCACAATCACATCCACTATTACACCAACTACTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Nonsense 2278 2870 32 47
Genomic Location:
Chromosome 25 (position 8594873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAATAATCTTGCCTGCCCAGAGTATGTGATTGTGAACTACAAATCATA[T/A]AGYATTAAGCTGACAAGYAACACCAAAGAGATTGAGGTAAGTCTGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073410 Nonsense 2302 2870 33 47
Genomic Location:
Chromosome 25 (position 8595045)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCNNGTTTCCCACAGGTYTATGTTAATGATGAWTTGAAACAACTAACTTA[C/A]GTCAATAACAACTTCTTCATCACCACCTCTGGCATTGGAGTCATTTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link