Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rab11fip4b
- Ensembl ID:
- ENSDARG00000070319
- ZFIN ID:
- ZDB-GENE-080722-8
- Description:
- Rab11 family-interacting protein 4B [Source:UniProtKB/Swiss-Prot;Acc:B3DGU2]
- Human Orthologue:
- RAB11FIP4
- Human Description:
- RAB11 family interacting protein 4 (class II) [Source:HGNC Symbol;Acc:30267]
- Mouse Orthologue:
- Rab11fip4
- Mouse Description:
- RAB11 family interacting protein 4 (class II) Gene [Source:MGI Symbol;Acc:MGI:2442920]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa6134 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6134
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000103077 | Essential Splice Site | 464 | 502 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 6 (position 19471928)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 21967143 GRCz11 6 18438464 - KASP Assay ID:
- 554-3826.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAAAGCACAGTCTCTGGCTATGGAGATTGATCATGCATCCCGTGACCAG[G/T]TAAGGGAAGTAAAGGACTTTGTTCTGTAAAGGGGATAGAGAACATGACTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
