irge4

Ensembl ID:
ENSDARG00000070317
ZFIN ID:
ZDB-GENE-051212-2
Description:
immunity-related GTPase family, e4 [Source:RefSeq peptide;Acc:NP_001076501]
Mouse Orthologues:
AC132320.1, Gm4841, Ifi47, Igtp, Iigp1, Irgc1, Tgtp1, Tgtp2
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma induced GTPase Gene [Source:MGI Symbol;Acc:MGI:107729]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
interferon inducible GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1926259]
interferon-inducible GTPase-like [Source:RefSeq peptide;Acc:NP_001094945]
predicted gene 4841 Gene [Source:MGI Symbol;Acc:MGI:3643814]
T-cell specific GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:98734]
T-cell specific GTPase 2 Gene [Source:MGI Symbol;Acc:MGI:3710083]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa194 Nonsense Confirmed mutation in F2 line During 2014
sa23 Nonsense Confirmed mutation in F2 line During 2014
sa18438 Nonsense Available for shipment Available now
sa4660 Nonsense Mutation detected in F1 DNA During 2014
sa24 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa194
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 122 713 1 7
Genomic Location:
Chromosome 16 (position 28067075)
KASP Assay ID:
554-0107.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAGGAAGTCCAAACTTCAAAGCAGATAAATACCTTAAAGATGTCAAAT[T/A]AAAAAATTATGACTTCTTCATTATTTTGAACTCCGAGAGGTTCATGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 231 713 2 7
Genomic Location:
Chromosome 16 (position 28066736)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAGCAGAAGAGCTTCCAGTCCATAAGAGAAATGCTCTCCTACAAGCCT[G/A]GCCGGTGTGCTCTGCTGCATCTTTGGAGATGAAGATCAAGATGTTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 None None 385 None 3
ENSDART00000086303 Nonsense 333 713 3 7
Genomic Location:
Chromosome 16 (position 28066236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGAGGTGCTGGACAGTGTTCGATAGCTCRTAGATGTCCGGTAATTG[T/A]ATTTTTGGAAAAAAGTGTTGTTTTTTTKATTGCTTTAATTGGTTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 Nonsense 17 385 3 3
ENSDART00000086303 Nonsense 416 713 7 7
Genomic Location:
Chromosome 16 (position 28063411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGACAGATGATTCTTCTGCTGACATGAATTTCTCTGGAGCTTTGCAG[A/T]GATTGGGTGAAAGTGACCCAAATGCAGCTGCTGTGAAGGCTAAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086301 Nonsense 168 385 3 3
ENSDART00000086303 Nonsense 567 713 7 7
Genomic Location:
Chromosome 16 (position 28062958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTTCGAAACAAGATTGATAATGACATTTGCTCAGTAGCGAATGGA[A/T]AAATCAACGAGCAGCAGCTGCTTTGCGCAATCAGGGAAGACTGCTACAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/izeufjmv