rhot1b

Ensembl ID:
ENSDARG00000070316
ZFIN ID:
ZDB-GENE-061009-52
Description:
mitochondrial Rho GTPase 1 [Source:RefSeq peptide;Acc:NP_001076295]
Human Orthologue:
RHOT1
Human Description:
ras homolog gene family, member T1 [Source:HGNC Symbol;Acc:21168]
Mouse Orthologue:
Rhot1
Mouse Description:
ras homolog gene family, member T1 Gene [Source:MGI Symbol;Acc:MGI:1926078]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9381 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051815 Nonsense 103 660 6 20
Genomic Location (Zv9):
Chromosome 6 (position 19336766)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22102305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATAATTTCCTTGTCACAGGTCACAAGTCATTGGATTCCCCTGATAAAT[G/T]AGAGGACAGACAAAGATAGCAGGTTGGCAGCTGGATGTATTTGTGGTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link