si:dkey-10p5.7

Ensembl ID:
ENSDARG00000070315
ZFIN ID:
ZDB-GENE-061207-47
Description:
hypothetical protein LOC100001623 [Source:RefSeq peptide;Acc:NP_001077345]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12005 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103058 Essential Splice Site 175 232 None 4
ENSDART00000138320 Essential Splice Site 174 174 None 4
Genomic Location (Zv9):
Chromosome 6 (position 19314753)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22124318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATTTACCGTTTCAGTTAAACCCTCACTTCTGATTTCCTCTCACCAAC[A/T]GTGTAAATGCCCTAAACGTAGAAAGTTGCAGCCTGTAGTTCCTGTTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link