rhbdl3

Ensembl ID:
ENSDARG00000070311
ZFIN ID:
ZDB-GENE-050417-2
Description:
rhomboid-related protein 3 [Source:RefSeq peptide;Acc:NP_001017556]
Human Orthologue:
RHBDL3
Human Description:
rhomboid, veinlet-like 3 (Drosophila) [Source:HGNC Symbol;Acc:16502]
Mouse Orthologue:
Rhbdl3
Mouse Description:
rhomboid, veinlet-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2179276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103045 Nonsense 338 407 9 9

The following transcripts of ENSDARG00000070311 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 19285227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCCGTGCTGTCTGGCTTCGGTGCTATCCCCCAGCCTTCCCACCATG[T/A]CCTAAYCCCAGCTTTGTGGCCCATCTGGGGGGTGTGGCAGTGGGCCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q0g0s10v