crlf3

Ensembl ID:
ENSDARG00000070261
ZFIN ID:
ZDB-GENE-050417-354
Description:
Cytokine receptor-like factor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q568M3]
Human Orthologue:
CRLF3
Human Description:
cytokine receptor-like factor 3 [Source:HGNC Symbol;Acc:17177]
Mouse Orthologue:
Crlf3
Mouse Description:
cytokine receptor-like factor 3 Gene [Source:MGI Symbol;Acc:MGI:1860086]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10525 Essential Splice Site Available for shipment Available now
sa40110 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8133 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Essential Splice Site None 444 None 9
ENSDART00000147712 Essential Splice Site None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35897424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAACTCCGCGGCAGAAGTTAATATGACACAAGACAGGATCGCTTAAGG[T/C]ACTGTTAAAAAATAACCGCCTATGTTTTTGCTACACTTYATCATTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Essential Splice Site 39 444 None 9
ENSDART00000147712 Essential Splice Site 39 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35902445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACTACAGCAGAGACTGCATGGACTCAGTCAGGCACGCAAACAGG[T/G]ACGAGTCTCTGCACTGCCACTGAAAGAATAAATCAGTGTCAGCAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Nonsense 195 444 5 9
ENSDART00000147712   None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35922962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGATTGAGGAGCTGGTGGAGAGACCAGGTGGTGTGCTGGTGCGTTG[G/A]TGTAAGGTGAGNNTGAAGACCACATTYATGTCCATCAGACATTTTCTTCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link