crlf3

Ensembl ID:
ENSDARG00000070261
ZFIN ID:
ZDB-GENE-050417-354
Description:
Cytokine receptor-like factor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q568M3]
Human Orthologue:
CRLF3
Human Description:
cytokine receptor-like factor 3 [Source:HGNC Symbol;Acc:17177]
Mouse Orthologue:
Crlf3
Mouse Description:
cytokine receptor-like factor 3 Gene [Source:MGI Symbol;Acc:MGI:1860086]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10525 Essential Splice Site Available for shipment Available now
sa8133 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Essential Splice Site None 444 None 9
ENSDART00000147712 Essential Splice Site None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35897424)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAACTCCGCGGCAGAAGTTAATATGACACAAGACAGGATCGCTTAAGG[T/C]ACTGTTAAAAAATAACCGCCTATGTTTTTGCTACACTTYATCATTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075903 Nonsense 195 444 5 9
ENSDART00000147712 None None 148 None 4

The following transcripts of ENSDARG00000070261 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 35922962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGATTGAGGAGCTGGTGGAGAGACCAGGTGGTGTGCTGGTGCGTTG[G/A]TGTAAGGTGAGNNTGAAGACCACATTYATGTCCATCAGACATTTTCTTCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qfp0ld51