ENSDARG00000070236

Ensembl ID:
ENSDARG00000070236
Human Orthologues:
DUPD1, DUSP13
Human Descriptions:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
dual specificity phosphatase and pro isomerase domain containing 1 [Source:HGNC Symbol;Acc:23481]
Mouse Orthologues:
Dupd1, Dusp13
Mouse Descriptions:
dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]
dual specificity phosphatase and pro isomerase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102924 Nonsense 32 190 2 5
Genomic Location:
Chromosome 23 (position 39288715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGAAGCTTGCAGAGTTATTACAAATAGAAGCCACCGTGAACAAATG[T/A]ACACTGCCCCTGTCACCATATACGGAGGTCTGGCGCAATGTCTACATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2bdqdfce