LOC100333269

Ensembl ID:
ENSDARG00000070230
Human Orthologue:
ALDH1L2
Human Description:
aldehyde dehydrogenase 1 family, member L2 [Source:HGNC Symbol;Acc:26777]
Mouse Orthologue:
Aldh1l2
Mouse Description:
aldehyde dehydrogenase 1 family, member L2 Gene [Source:MGI Symbol;Acc:MGI:2444680]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18774 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102893 Essential Splice Site 262 923 6 22
Genomic Location:
Chromosome 4 (position 8107621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTGGACATGATAAAGTTCCTGGTGCCTGGGTTGTGATGGATGGAAAG[G/A]TATTATTATAAGGGGACCCTTTGTTCATAACAACAACAACAACAAATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mzbc5hsr