LOC100333269

Ensembl ID:
ENSDARG00000070230
Human Orthologue:
ALDH1L2
Human Description:
aldehyde dehydrogenase 1 family, member L2 [Source:HGNC Symbol;Acc:26777]
Mouse Orthologue:
Aldh1l2
Mouse Description:
aldehyde dehydrogenase 1 family, member L2 Gene [Source:MGI Symbol;Acc:MGI:2444680]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18774 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31378 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102893 Essential Splice Site 262 923 6 22
Genomic Location:
Chromosome 4 (position 8107621)
KASP Assay ID:
2259-4511.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTGGACATGATAAAGTTCCTGGTGCCTGGGTTGTGATGGATGGAAAG[G/A]TATTATTATAAGGGGACCCTTTGTTCATAACAACAACAACAACAAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102893 Essential Splice Site 682 923 16 22
Genomic Location:
Chromosome 4 (position 8115786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGGTTTTACAGGCTCAACACCCATTGGCAAACAGATCATGAAGAGG[T/C]GAGGTTAATGTCAGTAAATTATTTTGTTTTTTGTTACTGTTATTGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link