nhsa

Ensembl ID:
ENSDARG00000070227
ZFIN ID:
ZDB-GENE-090617-1
Human Orthologue:
NHS
Human Description:
Nance-Horan syndrome (congenital cataracts and dental anomalies) [Source:HGNC Symbol;Acc:7820]
Mouse Orthologue:
Nhs
Mouse Description:
Nance-Horan syndrome (human) Gene [Source:MGI Symbol;Acc:MGI:2684894]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11777 Nonsense Available for shipment Available now
sa17321 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109567 Nonsense 609 1525 8 10
Genomic Location (Zv9):
Chromosome 23 (position 41500057)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41332772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTACCAATACTAATGATGATTCCACTGGCTTCATTATTGATCCGTA[T/A]CCTGGGGAYCGATTGCAAGGGCTCCGCAGCCATAGAACRGGTTCATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109567 Essential Splice Site 1320 1525 9 10
Genomic Location (Zv9):
Chromosome 23 (position 41502480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41335195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAAGTAAAAGTCGCACGACTGAAGATCTCTTTGCSATGATTCACAGG[T/C]GTGTTTYAATATAGTTTTGTACATATTTGATGTCCTTAAAAGYAGGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link