fam43b

Ensembl ID:
ENSDARG00000070222
ZFIN ID:
ZDB-GENE-040912-11
Description:
family with sequence similarity 43, member B [Source:RefSeq peptide;Acc:NP_001004547]
Human Orthologue:
FAM43B
Human Description:
family with sequence similarity 43, member B [Source:HGNC Symbol;Acc:31791]
Mouse Orthologue:
Fam43b
Mouse Description:
family with sequence similarity 43, member B Gene [Source:MGI Symbol;Acc:MGI:3651622]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44037 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102881 Nonsense 86 305 1 1
Genomic Location (Zv9):
Chromosome 23 (position 37422422)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37221650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCACCTATAATGTGCGTTACCTGGGCAGCGCGGTCACTATTGTGGCT[A/T]AAGGCGAGGACTGTACGCAGGAGGCGGTGGCTAAGATTTGGACCCGCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link