NP_001136427.1

Ensembl ID:
ENSDARG00000070217
Description:
hypothetical protein LOC751699 [Source:RefSeq peptide;Acc:NP_001136427]
Human Orthologue:
C1orf151
Human Description:
chromosome 1 open reading frame 151 [Source:HGNC Symbol;Acc:32068]
Mouse Orthologue:
2310028O11Rik
Mouse Description:
RIKEN cDNA 2310028O11 gene Gene [Source:MGI Symbol;Acc:MGI:1913628]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14048 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125739 Essential Splice Site 38 76 None 4
ENSDART00000132266   None 76 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 40046827)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39857680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTACKGGTCTGGGTCTAGGAATTGTGTTCTCTGTTGTATTCTTCAAGCG[T/G]AAGTGTACTACATAGTGCATGCCGAGTGAAGCTACTGTAGAGCTGCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link