si:ch211-120e1.1

Ensembl ID:
ENSDARG00000070215
ZFIN ID:
ZDB-GENE-070705-20
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PMK9]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18681 Essential Splice Site Available for shipment Available now
sa17061 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102872 Essential Splice Site 16 93 None 3
ENSDART00000145421 Essential Splice Site 17 63 None 2
Genomic Location (Zv9):
Chromosome 19 (position 41793170)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41245424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACGTGATATCGGTTGCCAGAGCACACGGAAGGATGAGTGGTRTTGAGG[T/A]ATTTATGCAACATTGCGTTAAATATTGCATTTATCATGTATAAATAGTAN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102872   53 93 3 3
ENSDART00000145421 Nonsense 55 63 2 2
Genomic Location (Zv9):
Chromosome 19 (position 41794952)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41247206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCATCCATGTCTCTCACAGAGGACCNAAACAGGCCAGCGTCCCTCCAGT[T/A]ATCTCAAGGCCAAGACATACCTGTTTAGGARGCAACTTCGGTATCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link