si:ch211-225p5.3

Ensembl ID:
ENSDARG00000070178
ZFIN ID:
ZDB-GENE-030131-5363
Description:
si:ch211-225p5.3 [Source:RefSeq peptide;Acc:NP_001156319]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2852 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2852
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102798 Nonsense 2 474 1 8
Genomic Location (Zv9):
Chromosome 16 (position 44825540)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42106048
KASP Assay ID:
554-2911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WTGGAAAACGTATYAAGGTTGCCAASACTGGTTGAGTGAATTCCTTGATG[C/T]GATTCAAAGATATGAAGCTTCATTTCCTCTTAATAATACTTTTATTTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link