ENSDARG00000070174

Ensembl ID:
ENSDARG00000070174
Human Orthologue:
MYO15B
Human Description:
myosin XVB pseudogene [Source:HGNC Symbol;Acc:14083]
Mouse Orthologues:
Myo15b, Myo3b
Mouse Descriptions:
myosin IIIB Gene [Source:MGI Symbol;Acc:MGI:2448580]
myosin XVB Gene [Source:MGI Symbol;Acc:MGI:2685534]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5216 Nonsense Mutation detected in F1 DNA During 2014
sa12019 Nonsense Available for shipment Available now
sa12795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102784 Nonsense 145 634 4 10
Genomic Location:
Chromosome 3 (position 37026947)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCAGAGGTTGTGGAGCACATTTATCAACATAATCCCATCCTGAGGTA[C/A]ACGCAGAGCCCACTGTACGCCCCACTGCTGCCTTTCCCCTACGGCAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102784 Nonsense 295 634 6 10
Genomic Location:
Chromosome 3 (position 37032841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGTGGAGAGCTAYGCGTCCTTCATTGGCCAGGCTCTAGAGAAGACC[C/T]GAGGCAGAGAGTGTGTGCCCTCGTGGGAGGAGATTCAAGGGCTGATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102784 Nonsense 452 634 9 10
Genomic Location:
Chromosome 3 (position 37038969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTTGTGAGGAAGATCTTCTTTCACTGGCGGCGCTGAGGCTGCAGTA[T/G]CTGCTGGGGGATTTCAGCGCCCTYTCTCCGTACCCGGCGCTAGAGCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ve1vrjjd