gria2a

Ensembl ID:
ENSDARG00000070173
ZFIN ID:
ZDB-GENE-020125-3
Description:
glutamate receptor, ionotropic, AMPA 2a [Source:RefSeq peptide;Acc:NP_571969]
Human Orthologue:
GRIA2
Human Description:
glutamate receptor, ionotropic, AMPA 2 [Source:HGNC Symbol;Acc:4572]
Mouse Orthologue:
Gria2
Mouse Description:
glutamate receptor, ionotropic, AMPA2 (alpha 2) Gene [Source:MGI Symbol;Acc:MGI:95809]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12891 Nonsense Available for shipment Available now
sa8383 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077805 None None 250 None 5
ENSDART00000102782 Nonsense 768 875 14 16
ENSDART00000138791 Nonsense 697 804 12 14
Genomic Location:
Chromosome 1 (position 20120583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCGTTTGTTTAAGAAACGCGGTAAACCTTGCAGTGCTAAAACTGAAY[G/T]AGCAGGGGCTTCTGGWTAAATTGAAAAACAAATGGTGGTAMGACAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077805 None None 250 None 5
ENSDART00000102782 Nonsense 781 875 14 16
ENSDART00000138791 Nonsense 710 804 12 14
Genomic Location:
Chromosome 1 (position 20120542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGAAYGAGCAGGGGCTTCTGGWTAAATTGAAAAACAAATGGTGGTA[C/A]GACAAAGGAGAGTGCGGCAGCGGAGGCGGGGAGTCAAAGGTCAGACCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nntue6in