ubr2

Ensembl ID:
ENSDARG00000070164
ZFIN ID:
ZDB-GENE-081107-29
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JR95]
Human Orthologue:
UBR2
Human Description:
ubiquitin protein ligase E3 component n-recognin 2 [Source:HGNC Symbol;Acc:21289]
Mouse Orthologue:
Ubr2
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 2 Gene [Source:MGI Symbol;Acc:MGI:1861099]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6283 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14897 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102748 None None 952 None 26
ENSDART00000108517 None None 492 None 15
ENSDART00000114040 Essential Splice Site 533 1730 13 47
Genomic Location:
Chromosome 13 (position 2989160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCTCACACATATCATCTCCATGATGCAGGAGTGGTGTGCCAGTGACG[T/A]GAGTTAATGCATACMYACAAACTACTACTCMCTCCTTACAATGACTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102748 Nonsense 773 952 22 26
ENSDART00000108517 Nonsense 313 492 11 15
ENSDART00000114040 Nonsense 1551 1730 43 47
Genomic Location:
Chromosome 13 (position 2959375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTGGAGAAGTGGTTGAATAGCTGTTGTTTGTGCTGTGCAGGTGGTG[T/A]TCTCATCCAGCTCTTCAGGCYCTTCAGAGCAGYRTGACTCTCATCAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6c6kqveh