tgm2

Ensembl ID:
ENSDARG00000070157
ZFIN ID:
ZDB-GENE-040912-78
Description:
transglutaminase 2 [Source:RefSeq peptide;Acc:NP_001004647]
Human Orthologue:
TGM2
Human Description:
transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
Mouse Orthologue:
Tgm2
Mouse Description:
transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4226 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37788 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102712 Essential Splice Site 359 679 9 13

The following transcripts of ENSDARG00000070157 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 43632505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCCTGATAATTGCAATATAAACACCTGCCATTTGTTTTCCTCCTKTC[A/T]GGCGTATTCTGTTGTGGACCAGCCTCTGTGAGAGCTATTAAAGAGGGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102712 Nonsense 524 679 10 13

The following transcripts of ENSDARG00000070157 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 43634805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTACAATGGCACACTTGGAGAGACCTGCGGACTGGGAGAGTTTACG[G/T]AGATTAGCTTAGCTTCTTCTGAAGGTAAGACATGTTTAACTAGTAGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link