tgm2

Ensembl ID:
ENSDARG00000070157
ZFIN ID:
ZDB-GENE-040912-78
Description:
transglutaminase 2 [Source:RefSeq peptide;Acc:NP_001004647]
Human Orthologue:
TGM2
Human Description:
transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
Mouse Orthologue:
Tgm2
Mouse Description:
transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4226 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102712 Essential Splice Site 359 679 9 13

The following transcripts of ENSDARG00000070157 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 43632505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCCTGATAATTGCAATATAAACACCTGCCATTTGTTTTCCTCCTKTC[A/T]GGCGTATTCTGTTGTGGACCAGCCTCTGTGAGAGCTATTAAAGAGGGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qbv7e1yh