tuba8l3

Ensembl ID:
ENSDARG00000070155
ZFIN ID:
ZDB-GENE-040801-77
Description:
tubulin, alpha 8 like 3 [Source:RefSeq peptide;Acc:NP_001003558]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102715 None None 450 None 4
ENSDART00000125494 Nonsense 83 577 2 5

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 7720874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGACTGACACTTTCAGCTTTTTGTAAATGTAGATGAAGTGCGGACA[G/T]GAACCTACCGCCAGCTCTTCCACCCTGAACAACTGATTACTGGGAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hsh31kvy