si:ch1073-268b21.1

Ensembl ID:
ENSDARG00000070145
ZFIN ID:
ZDB-GENE-081105-13
Description:
Novel protein similar to H.sapiens MAGI1, membrane associated guanylate kinase, WW and PDZ domain co
Human Orthologues:
MAGIX, SAV1
Human Descriptions:
MAGI family member, X-linked [Source:HGNC Symbol;Acc:30006]
salvador homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17795]
Mouse Orthologues:
Magix, Sav1
Mouse Descriptions:
MAGI family member, X-linked Gene [Source:MGI Symbol;Acc:MGI:1859644]
salvador homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927144]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31691 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102696 Nonsense 1136 1299 20 20
ENSDART00000131494   None 334 None 9
ENSDART00000134420   None 225 None 6
ENSDART00000142217 Nonsense 1215 1378 21 21

The following transcripts of ENSDARG00000070145 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55703709)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53665594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGCGAGGCCGCAAACCGTCCACAGACCCCCAGAGCAGCTCAGGCTCT[C/T]AGGTGCGCAGCGGGTCCCTGGACCGCTCCTCCGGCCGAAAGCGCAACCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link