aste1

Ensembl ID:
ENSDARG00000070132
ZFIN ID:
ZDB-GENE-060503-520
Description:
Protein asteroid homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LYL8]
Human Orthologue:
ASTE1
Human Description:
asteroid homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:25021]
Mouse Orthologue:
Aste1
Mouse Description:
asteroid homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913845]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1864 Nonsense F2 line generated During 2014
sa18428 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1864
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102665 Nonsense 143 692 2 5
ENSDART00000121448 Nonsense 143 692 1 4
Genomic Location:
Chromosome 16 (position 44341543)
KASP Assay ID:
554-1855.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAGAAGCTCAAGGTACCGGTGGTGCAGACTCTYGAAGAGGCCGATTG[G/A]GAAATTGCAGCGTTGGCAGAAGAATGGAATTGTCCAGTTTTGTCCAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102665 Nonsense 527 692 4 5
ENSDART00000121448 Nonsense 527 692 3 4
Genomic Location:
Chromosome 16 (position 44345529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGCCGAAAAGGAGGCTCTGTGGATATTGATGTCGCTCATGCTTACAGC[C/T]AGTGGCAGTCCTGTCTGAAGKACAGCCTCAATCTCAACTATCTGCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pot02ly1