barhl2

Ensembl ID:
ENSDARG00000070129
ZFIN ID:
ZDB-GENE-050913-153
Description:
barH-like 2 homeobox protein [Source:RefSeq peptide;Acc:NP_991303]
Human Orthologue:
BARHL2
Human Description:
BarH-like homeobox 2 [Source:HGNC Symbol;Acc:954]
Mouse Orthologue:
Barhl2
Mouse Description:
BarH-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859314]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33851 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102661 Essential Splice Site 261 364 None 3

The following transcripts of ENSDARG00000070129 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 21032613)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24720507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAAACCTCACAGACACACAAGTAAAGACTTGGTATCAAAACCGACGG[T/C]AAGTGTCATATTAATATTTATGAATATTATTTTTGTTATGGCTCACATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link