NFXL1

Ensembl ID:
ENSDARG00000070127
Description:
nuclear transcription factor, X-box binding-like 1 [Source:HGNC Symbol;Acc:18726]
Human Orthologue:
NFXL1
Human Description:
nuclear transcription factor, X-box binding-like 1 [Source:HGNC Symbol;Acc:18726]
Mouse Orthologue:
Nfxl1
Mouse Description:
nuclear transcription factor, X-box binding-like 1 Gene [Source:MGI Symbol;Acc:MGI:1923646]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37790 Nonsense Mutation detected in F1 DNA During 2017
sa39428 Nonsense Mutation detected in F1 DNA During 2017
sa37791 Nonsense Mutation detected in F1 DNA During 2017
sa30003 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102658 Nonsense 252 822 6 20
Genomic Location (Zv9):
Chromosome 23 (position 44065079)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44095246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTTTCAGGCCCGTGTCCCCCCTGCCCACAGATGGTGAGTGTGT[C/A]GTGTCTGTGTGGGAAATCGTCTCGTGTTCCTCGCCGCTGCAGTGCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102658 Nonsense 313 822 7 20
Genomic Location (Zv9):
Chromosome 23 (position 44065354)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44095521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGCATGCCCGAGGGTCAGTCTGCAGGCGTGTGCGTGTGGCCGACAG[C/T]GAGCAGAGAGACCCTGCGCCAGTCCAGAGTGGCACTGTGACCAGGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102658 Nonsense 720 822 18 20
Genomic Location (Zv9):
Chromosome 23 (position 44092967)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44123058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTTTGCAGGAAGTTTACATCTGCTGATGAA[C/T]AAGACAAACAGCTGCTGATGTCCTGCCAGAATCAGTGTCCAAAACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102658 Essential Splice Site 770 822 19 20
Genomic Location (Zv9):
Chromosome 23 (position 44094203)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44124294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGGTCAGAAGGTGAAGATCAGGTGTCCCTGCAAGAGGATCAAAAAGG[T/C]AAAAAACACACAGAATGTCACATGACACTGTCCATCACACACTCAAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link