ptpn23a

Ensembl ID:
ENSDARG00000070124
ZFIN ID:
ZDB-GENE-100921-24
Human Orthologue:
PTPN23
Human Description:
protein tyrosine phosphatase, non-receptor type 23 [Source:HGNC Symbol;Acc:14406]
Mouse Orthologue:
Ptpn23
Mouse Description:
protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25027 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32106 Nonsense Available for shipment Available now
sa36225 Nonsense Mutation detected in F1 DNA During 2017
sa1072 Nonsense F2 line generated During 2017
sa36224 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102649 Essential Splice Site 42 1893 1 26
ENSDART00000145956 Essential Splice Site 28 2003 1 24
Genomic Location (Zv9):
Chromosome 16 (position 43796960)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41181353
KASP Assay ID:
554-7340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATCTAAAGGAGGCAGGAGAGTTTCAATTCAGCCCGACTGTCAAACAG[G/A]TGAGGGACCAGACAGGCCTGATCGAGCCGTTCATTTATGTCACTGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102649 Nonsense 126 1893 4 26
ENSDART00000145956 Nonsense 112 2003 4 24
Genomic Location (Zv9):
Chromosome 16 (position 43790832)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41175225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGGAGATATTTTCTGGGAAGACGGTGACCCATGAGGACATCTGCTA[T/G]GAGCAGGCCTGCATCCTTTATAATTTGGGTGAGTTAGCATGAGACCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102649 Nonsense 242 1893 8 26
ENSDART00000145956 Nonsense 228 2003 8 24
Genomic Location (Zv9):
Chromosome 16 (position 43787165)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41171558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTATTACAAAGAGGCATGCAGGGCTTTGGAGAACTCTGAAACCGCTT[C/A]GATGTTGGGAAAGATCCAAAAAGACTGGAAGAAATTAGTGCAAATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1072
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102649 Nonsense 1095 1893 21 26
ENSDART00000145956 Nonsense 1203 2003 19 24
Genomic Location (Zv9):
Chromosome 16 (position 43781400)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41165793
KASP Assay ID:
554-0974.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCATCCACAGATGCCCTCAGTCTCTCAGCCACCACCTCACTGCCCC[C/T]AATCCCATATAATTCCTGCTCATCAACCAAATCAACAACCACCATACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102649 Essential Splice Site 1517 1893 21 26
ENSDART00000145956 Essential Splice Site 1625 2003 19 24
Genomic Location (Zv9):
Chromosome 16 (position 43780131)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41164524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGTTTCTGTAATCGTCATGCTAGTGTCTGAGCAAGAACTAGAGAAG[G/A]TAAATGTTTAATGTTAATGGATTTTTTGGTAATTTCTACAATCTCGTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link