ncapg

Ensembl ID:
ENSDARG00000070109
ZFIN ID:
ZDB-GENE-041111-282
Description:
Si:dkeyp-26a9.1 protein [Source:UniProtKB/TrEMBL;Acc:Q58EG5]
Human Orthologue:
NCAPG
Human Description:
non-SMC condensin I complex, subunit G [Source:HGNC Symbol;Acc:24304]
Mouse Orthologue:
Ncapg
Mouse Description:
non-SMC condensin I complex, subunit G Gene [Source:MGI Symbol;Acc:MGI:1930197]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32673 Nonsense Mutation detected in F1 DNA During 2017
sa32674 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39609 Nonsense Mutation detected in F1 DNA During 2017
sa19499 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102609 Nonsense 190 1003 4 21
ENSDART00000133659 Nonsense 190 1003 5 22
ENSDART00000142879   None 178 None 6
Genomic Location (Zv9):
Chromosome 1 (position 22335805)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22870972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAAATAAATAAATTTAATTCTGTTTGTGTATAGCTTATGTTCTGCTTT[T/A]GGAAAATGACTCAAACCCTGAGGTTCGTCGTGCTGTGCTGTCCTGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102609 Essential Splice Site 377 1003 8 21
ENSDART00000133659 Essential Splice Site 377 1003 9 22
ENSDART00000142879   None 178 None 6
Genomic Location (Zv9):
Chromosome 1 (position 22336984)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22872151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATGGATAATAAACTAATATTCAGCTTAACAAGAGCCTTTTTGTTTCA[G/T]TTTTCTAAAGAGCATTACTCAGCTGTCTGAGGCGCAAAGAGCTGATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102609 Nonsense 432 1003 9 21
ENSDART00000133659 Nonsense 432 1003 10 22
ENSDART00000142879   None 178 None 6
Genomic Location (Zv9):
Chromosome 1 (position 22337442)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22872609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTAACCTTCTCAACTACTGTTTAGGAAGCGCATGGTAGCAGTGCTG[C/T]AGGAGATACTTGTGATGCCCAACACACCTGTTTCTCTGATTGGTCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102609 Nonsense 762 1003 15 21
ENSDART00000133659 Nonsense 762 1003 16 22
ENSDART00000142879   None 178 None 6
Genomic Location (Zv9):
Chromosome 1 (position 22340887)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22876054
KASP Assay ID:
2259-0565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTAACCGAGGATGACCAAAGACTGCGCCATTGTCTGGGAGTTTTCT[T/A]ACAACTGTATGCTCGAGCAAGCAGGTATGCATCTGGTCAGGTACTTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link