lcorl

Ensembl ID:
ENSDARG00000070098
ZFIN ID:
ZDB-GENE-030131-6300
Human Orthologue:
AC005768.1
Mouse Orthologue:
AC132303.1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1601 Essential Splice Site Available for shipment Available now
sa10356 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102600 None None 146 None 3
ENSDART00000134860 Essential Splice Site 3 217 1 7
ENSDART00000138852 Essential Splice Site 33 1673 1 8
Genomic Location:
Chromosome 1 (position 22369865)
KASP Assay ID:
554-1542.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGCGGGAACTCGACTCATGGCGACACAAGCTCATTCAGTGTGTCG[G/A]TAAGATTAAAATTGCCTTGTTCGGGAAAGCCAAAGTTGCATAGCTCCGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102600 None None 146 None 3
ENSDART00000134860 None None 217 None 7
ENSDART00000138852 Nonsense 1420 1673 7 8
Genomic Location:
Chromosome 1 (position 22352905)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAGACCCAATTGCAAAGTKAATGCTTGCCCAAGTCCACAAGCAGAG[C/T]GACTCAGGAAACATGTAAAAAAAKTTGCTAAAATCGTTCCAAAGAGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n1vc0wjc