lcorl

Ensembl ID:
ENSDARG00000070098
ZFIN ID:
ZDB-GENE-030131-6300
Human Orthologue:
AC005768.1
Mouse Orthologue:
AC132303.1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1601 Essential Splice Site Available for shipment Available now
sa32675 Nonsense Mutation detected in F1 DNA During 2016
sa10356 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102600   None 146 None 3
ENSDART00000134860 Essential Splice Site 3 217 1 7
ENSDART00000138852 Essential Splice Site 33 1673 1 8
Genomic Location (Zv9):
Chromosome 1 (position 22369865)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22905032
KASP Assay ID:
554-1542.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCGGCGGGAACTCGACTCATGGCGACACAAGCTCATTCAGTGTGTCG[G/A]TAAGATTAAAATTGCCTTGTTCGGGAAAGCCAAAGTTGCATAGCTCCGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102600 Nonsense 113 146 3 3
ENSDART00000134860   None 217 None 7
ENSDART00000138852   None 1673 None 8
Genomic Location (Zv9):
Chromosome 1 (position 22360757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22895924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGTGAGAACGGCAGGAGCACAGAGGCAGTGTGGCCCACCAGTGACACA[C/T]GACTTGTCCTACAGAAGGTAGCAGCATGGGCTCGCTCGCAGTCTGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102600   None 146 None 3
ENSDART00000134860   None 217 None 7
ENSDART00000138852 Nonsense 1420 1673 7 8
Genomic Location (Zv9):
Chromosome 1 (position 22352905)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22888072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCAGACCCAATTGCAAAGTKAATGCTTGCCCAAGTCCACAAGCAGAG[C/T]GACTCAGGAAACATGTAAAAAAAKTTGCTAAAATCGTTCCAAAGAGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link