phf10

Ensembl ID:
ENSDARG00000070084
ZFIN ID:
ZDB-GENE-040426-1573
Description:
PHD finger protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWE1]
Human Orthologue:
PHF10
Human Description:
PHD finger protein 10 [Source:HGNC Symbol;Acc:18250]
Mouse Orthologue:
Phf10
Mouse Description:
PHD finger protein 10 Gene [Source:MGI Symbol;Acc:MGI:1919307]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1287 Essential Splice Site F2 line generated During 2017
sa42132 Nonsense Mutation detected in F1 DNA During 2017
sa5857 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1287
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102563 Essential Splice Site 23 490 1 12
ENSDART00000121598 Essential Splice Site 23 369 1 9
Genomic Location (Zv9):
Chromosome 13 (position 5655961)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5850419
KASP Assay ID:
554-1202.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGACCGTGCGATAGCAAYCCTGCRACTCCTGGGACCCAGTCTATAARG[G/A]TTTGTGATGTTTACTTACTACTTTTTCTTAGCAGAAGCTGYAGATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102563 Nonsense 82 490 3 12
ENSDART00000121598 Nonsense 82 369 3 9
Genomic Location (Zv9):
Chromosome 13 (position 5659112)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5853570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAACCTGACAGAATACAAATGGCCTCCGGATGACACGGGAGAGTATTA[T/A]ATGTTACAAGAACAAGTGAGCGAGTACTTGGGAGTCACGTCATTCAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102563 Nonsense 100 490 3 12
ENSDART00000121598 Nonsense 100 369 3 9
Genomic Location (Zv9):
Chromosome 13 (position 5659164)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 5853622
KASP Assay ID:
554-3771.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTACAAGAACAAGTGAGCGAGTACTTGGGAGTCACGTCATTCAAGCGC[A/T]AATACCCAGGTATGWGTGAAATTGCRCTRAGGAATTTGTATGTGCTTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link