nbea

Ensembl ID:
ENSDARG00000070080
ZFIN ID:
ZDB-GENE-050320-68
Description:
neurobeachin [Source:RefSeq peptide;Acc:NP_001013518]
Human Orthologue:
NBEA
Human Description:
neurobeachin [Source:HGNC Symbol;Acc:7648]
Mouse Orthologue:
Nbea
Mouse Description:
neurobeachin Gene [Source:MGI Symbol;Acc:MGI:1347075]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38806 Nonsense Mutation detected in F1 DNA During 2017
sa21772 Nonsense Available for shipment Available now
sa34946 Nonsense Mutation detected in F1 DNA During 2017
sa21773 Nonsense Available for shipment Available now
sa21774 Nonsense Available for shipment Available now
sa21775 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 397 2968 8 58
ENSDART00000114630   None 2355 None 45
ENSDART00000144529 Nonsense 397 607 8 12
Genomic Location (Zv9):
Chromosome 10 (position 35616779)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34645040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGCAACTCGGAGCTGTGTACGTTTTCAGCGAGGCACTGAACCCCGCA[C/T]AGATCTTTGCCATTCATCAACTCGGACCGGGATATAAGGTATAGACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 947 2968 22 58
ENSDART00000114630 Nonsense 340 2355 10 45
ENSDART00000144529   None 607 None 12
Genomic Location (Zv9):
Chromosome 10 (position 35689932)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34717919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTAGATTCACACTACAACCCTTGATCTTGACCCCTTTAGGTGACCTA[C/A]GAGGCGCATAAGGAGTACCTGGCAAAGATGTATGAGGAATATCAACGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 1312 2968 23 58
ENSDART00000114630 Nonsense 705 2355 11 45
ENSDART00000144529   None 607 None 12
Genomic Location (Zv9):
Chromosome 10 (position 35693117)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34721104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACCTGCGTGTGGATCTGGGTTTCCGGGGAATGCCTATGACTGAAGAA[C/T]AGCGGCGGCAGTTCAGCCCAGGCCCTCGCACTACCATGTTCCGTATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 1458 2968 26 58
ENSDART00000114630 Nonsense 843 2355 13 45
ENSDART00000144529   None 607 None 12
Genomic Location (Zv9):
Chromosome 10 (position 35699235)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34727222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGGTGGACGTGTTGGTGTTTGCCAGTTCTCTGAACTTCAGCGAGATT[G/T]AGGCTGAGAAGAACATGTCTTCAGGTGGACTGATGCGCCAGTGCCTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 2181 2968 41 58
ENSDART00000114630 Nonsense 1568 2355 28 45
ENSDART00000144529   None 607 None 12
Genomic Location (Zv9):
Chromosome 10 (position 35735111)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34763098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGTTTGATGTTTTCTTTCAGGTCCTGTGGTTTTGAGCACTCCGGCT[C/T]AGCTGGTTGCTCCTGTGATTGTGGCTAGAGGGACGTTGTCCATCACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102566 Nonsense 2274 2968 43 58
ENSDART00000114630 Nonsense 1661 2355 30 45
ENSDART00000144529   None 607 None 12
Genomic Location (Zv9):
Chromosome 10 (position 35735705)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 34763692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCATGTTCAACTTCCCAGATCAGGCCACCGTGAAGAAAGTAGTGTA[C/A]AGTTTACCTCGGGTCGGCGTCGGAACCAGCTATGGCCTTCCACAGGCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link