ABCB11

Ensembl ID:
ENSDARG00000070078
Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 [Source:HGNC Symbol;Acc:42]
Human Orthologue:
ABCB11
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 [Source:HGNC Symbol;Acc:42]
Mouse Orthologue:
Abcb11
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 Gene [Source:MGI Symbol;Acc:MGI:1351619]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6199 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6200 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102557 Essential Splice Site 969 1352 22 28
Genomic Location:
Chromosome 11 (position 13440918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTGGATTCGCCAAGCAGGACAAAGAGGCCATGGAGACAGCAGGGCAG[G/A]TGAGCTCATGCTACACTGCAGTAGTGGAGATCAAAATTAGAACAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102557 Essential Splice Site 1286 1352 27 28
Genomic Location:
Chromosome 11 (position 13453822)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCTTCTRGATGAGGCCACCTCAGCACTAGACACAGAAAGYGAGAAG[G/A]TGAGCAGGAAAGCYAGCAAAACGAGTTTTAGAAGATGTTTAAGAGGTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zi4ienfx