LOC557734

Ensembl ID:
ENSDARG00000070074
Human Orthologue:
LRP8
Human Description:
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor [Source:HGNC Symbol;Ac
Mouse Orthologue:
Lrp8
Mouse Description:
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Gene [Source:MGI Symbo

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20743 Nonsense Mutation detected in F1 DNA During 2014
sa20742 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Nonsense 388 984 8 19
Genomic Location:
Chromosome 6 (position 35090709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTAAAGACCGGCAGATCGGCTTCGAGTGTCAATGCCCCTCGGGCTA[C/A]AAGCTCCTGGACAAGAAGACTTGTGGAGGTAACATCAATACTGCTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Essential Splice Site 440 984 9 19
Genomic Location:
Chromosome 6 (position 35090299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGAAGGCTACGAGATGGACCCAGTTACCAAGACGTGTAAAGCAGTGGG[T/G]AAGACAGTATACATTAACATCTCCATCAATCACTTTTCTGAACAGTGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4iiw8s9r