LOC557734

Ensembl ID:
ENSDARG00000070074
Human Orthologue:
LRP8
Human Description:
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor [Source:HGNC Symbol;Ac
Mouse Orthologue:
Lrp8
Mouse Description:
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Gene [Source:MGI Symbo

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33898 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30873 Nonsense Mutation detected in F1 DNA During 2016
sa20743 Nonsense Mutation detected in F1 DNA During 2016
sa20742 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33897 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Essential Splice Site 147 984 4 19
Genomic Location:
Chromosome 6 (position 35143296)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAAGAGACTGTGAAAATGGAGCAGACGAGGAGCAGTGTGCCGCAGG[T/C]AAGACCACAGAGAGAAAAAGAAATGGCTAAAAATAGAGCCTGTCTGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Nonsense 297 984 6 19
Genomic Location:
Chromosome 6 (position 35105825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTGATCAGTTCCAGTGTGGCGACGGCTCCTGCATTCACGGCACTAAA[C/T]AGTGTAACAAAGTGCACGACTGTCCAGATTTCAGCGACGAGGCCGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Nonsense 388 984 8 19
Genomic Location:
Chromosome 6 (position 35090709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTAAAGACCGGCAGATCGGCTTCGAGTGTCAATGCCCCTCGGGCTA[C/A]AAGCTCCTGGACAAGAAGACTTGTGGAGGTAACATCAATACTGCTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Essential Splice Site 440 984 9 19
Genomic Location:
Chromosome 6 (position 35090299)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGAAGGCTACGAGATGGACCCAGTTACCAAGACGTGTAAAGCAGTGGG[T/G]AAGACAGTATACATTAACATCTCCATCAATCACTTTTCTGAACAGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102554 Nonsense 484 984 10 19
Genomic Location:
Chromosome 6 (position 35071933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGACCCTGAAGAATGCTGTGGCCCTGGATGTGGATGTTACCACCAAC[A/T]AGATGTACTGGTGTGACCTTTATCATCGCAAGATCTTCAGGTACACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link