ENSDARG00000070073

Ensembl ID:
ENSDARG00000070073

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21869 Nonsense Available for shipment Available now
sa1494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102548 Nonsense 82 414 2 9
Genomic Location:
Chromosome 11 (position 13692930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACTCACGCAGATTTTAAGCCCATGCCCATGTCCGCAGCCCAACTATG[T/A]CGACCCACCACCACAGGCTGGATAAATTTGCTGGAAGTTAAAAGTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102548 Nonsense 164 414 4 9
Genomic Location:
Chromosome 11 (position 13695349)
KASP Assay ID:
554-1419.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCAATGACATGTTTGCNTTTTATTTCATTGCATCTTTTATTTAGCAA[C/T]GAATTCAGTATTCATCTGTTGCAATGGGAGACCGAGACAAGATACTGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1wugzqk9