ENSDARG00000070073

Ensembl ID:
ENSDARG00000070073

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21869 Nonsense Available for shipment Available now
sa1494 Nonsense Available for shipment Available now
sa31821 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102548 Nonsense 82 414 2 9
Genomic Location (Zv9):
Chromosome 11 (position 13692930)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13449753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACTCACGCAGATTTTAAGCCCATGCCCATGTCCGCAGCCCAACTATG[T/A]CGACCCACCACCACAGGCTGGATAAATTTGCTGGAAGTTAAAAGTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102548 Nonsense 164 414 4 9
Genomic Location (Zv9):
Chromosome 11 (position 13695349)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13452172
KASP Assay ID:
554-1419.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCAATGACATGTTTGCNTTTTATTTCATTGCATCTTTTATTTAGCAA[C/T]GAATTCAGTATTCATCTGTTGCAATGGGAGACCGAGACAAGATACTGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102548 Nonsense 188 414 4 9
Genomic Location (Zv9):
Chromosome 11 (position 13695423)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 13452246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGAGACCGAGACAAGATACTGAACAATCAAACAACTTATTCCACCTA[T/A]TTTAGACCATCAGATGACAACAGGTGATAATATTGTAATTCTGTATGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link