pitx3

Ensembl ID:
ENSDARG00000070069
ZFIN ID:
ZDB-GENE-041229-4
Description:
paired-like homeodomain transcription factor 3 [Source:RefSeq peptide;Acc:NP_991238]
Human Orthologue:
PITX3
Human Description:
paired-like homeodomain 3 [Source:HGNC Symbol;Acc:9006]
Mouse Orthologue:
Pitx3
Mouse Description:
paired-like homeodomain transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:1100498]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45 Essential Splice Site Confirmed mutation in F2 line During 2017
hu3263 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa45
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102538 Essential Splice Site 105 293 3 4
Genomic Location (Zv9):
Chromosome 13 (position 6668455)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7232768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGAGGAGATTGCGGTGTGGACCAACCTCACAGAAGCAAGAGTACGGG[T/C]ACGTGTGTCCCTGCCAAACTAAACCGCTGCATAGCTACGGCACATTGTGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3263
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102538 Nonsense 250 293 4 4
Genomic Location (Zv9):
Chromosome 13 (position 6676223)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7225000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCAGCCGCCTGCCCGTATGCCACCACGGCCGGTCCATACATGTAC[A/T]GAGACACCTGTAACTCCAGTCTGGCCAGCCTCCGGCTCAAGGCCAAACAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link