rgs4

Ensembl ID:
ENSDARG00000070047
ZFIN ID:
ZDB-GENE-030131-9839
Description:
regulator of G-protein signaling 4 [Source:RefSeq peptide;Acc:NP_954968]
Human Orthologue:
RGS4
Human Description:
regulator of G-protein signaling 4 [Source:HGNC Symbol;Acc:10000]
Mouse Orthologue:
Rgs4
Mouse Description:
regulator of G-protein signaling 4 Gene [Source:MGI Symbol;Acc:MGI:108409]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20740 Nonsense Available for shipment Available now
sa31522 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102483 Nonsense 179 215 5 5
ENSDART00000133783   None 117 None 5
Genomic Location (Zv9):
Chromosome 6 (position 34381946)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35381541
KASP Assay ID:
2259-7749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCTTCACTCTTATGGAAAAAGACTCGTATCGGCGATTCCTGAGATCC[A/T]GATTGTTCCTGGAACTGTCTCAACCTGCGATGGACAACAAACCCTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102483 Nonsense 211 215 5 5
ENSDART00000133783   None 117 None 5
Genomic Location (Zv9):
Chromosome 6 (position 34381849)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35381638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTTAGAGAAGAAAGTAAAGCGACAGATTTCTGACTACAGTCAGTGTT[T/A]GCCTAGTTATGCCTAAACAGAGCCGTCTGCTCCTACATGAACAAAAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link